Sub-navigation links

 

Pop Quiz

Can You Survive Freshman Year at MIT?

Drawing of MIT's mascot studying hard.

Freshman year at MIT can be described as a crash course of work and play. This is the year freshmen discover academic tracks that stimulate their curiosity, passion, and in some cases antipathy.

Which academic track would you choose if you were a MIT freshman? Take this pop quiz to find out.


Question #1 - Materials Science and Engineering

A melt of borate glass, g1, cooled at rate, r1, has glass transition temperature, Tg1. If a second specimen of molten g1 is cooled at a new rate, r2, such that r2 < r1, how does the glass transition temperature, Tg2, compare to Tg1? Explain with reference to atomic structure.

Check your answer


Question #2 - Mathematics

Show that the vector field below is conservative.
F = <exyz, exz + 2yz, exy + y2 + 1>

Check your answer


Question #3 - Brain and Cognitive Sciences

Given the difficulty getting cheap airline tickets, one strategy is to make three reservations on different airlines at the same time for one person. Consider the following three objections to this strategy: (a) you know your mother and friends would disapprove of it if they knew you used this strategy; (b) using this strategy would unfairly hurt the people who want the same flights; (c) you could get caught and possibly fined or punished. According to Lawrence Kohlberg, how would you order these three reasons in terms of the development of moral reasoning? Put the earliest stage first.

Check your answer


Question #4 - Physics

An airplane flies between two cities separated by a distance D. Assume the wind blows directly from one city to the other at a speed Va and the speed of the airplane is V0 relative to the air. (a) How long does it take for the airplane to make a round trip between the two cities? (b) To an observer on the ground, what is the average speed of the airplane for such a round trip? (c) To an observer on the ground, what is the average velocity for the round trip?

Check your answer


Question #5 - Chemistry

Zinc and cobalt are both transition metals that play important roles in biological systems. Why are zinc complexes colorless, while cobalt(III) complexes are brightly colored?

Check your answer


Question #6 - Biology

This is an example of the polymerase chain reaction. Try to clone the GOSH ("gene from the outer space H").

5'GGATCC 3' BamHI recognition sequence
5'CTCGAG 3' XhoI recognition sequence
5'GCGGCCGC 3' NotI recognition sequence
5'GTCGAC 3' SalI recognition sequence

Since pEA (amphibian expression plasmid) does not contain NotI and SalI sites, you decide to PCR-amplify GOSH with primers that will replace the SalI and NotI sites with BamHI and XhoI sites. You know the sequences of the 5' and 3' ends of GOSH as they are in the bacterial plasmid:

In the pEA, the amphibian promoter is positioned in relation to the restriction sites XhoI and BamHI according to the diagram below:

|amphibian promoter|--|XhoI|--|BamHI|

StartStop
5'GTCGACatggtcgccatgcga………………………..tgctcgatatcgtaaGCGGCCGC3'
SalINotI

Which of the following primer pairs would you use to successfully amplify GOSH with the desired restriction sites at either end? All primer sequences are written in the 5' → 3' direction. Choose all that apply.

Pair1: GTCGACATGGTCGCCATGCGA and GCGGCCGCTTACGATATCGAG
Pair2: TCGCATGGCGACCATGTCGAC and GGATCACTACGAGATCGAGCA
Pair3: GGATCCATGGTCGCCATGCGA and CTCGAGTTACGATATCGAGCA
Pair4: TCGCATGGCGACCATCTCGAG and TGCTCGATATCGTAAGGATCC
Pair5: CTCGAGATGGTCGCCATGCGA and GGATCCTTACGATATCGAGCA

Check your answer


Question #7 - Political Science

In the Supreme Court case, San Antonio v. Rodriguez, the challengers in San Antonio argue economic and educational discrimination against people who live in poorer districts. Why does the Supreme Court reject a case for discrimination?

Check your answer


Question #8 - Electrical Engineering and Computer Science

The capacitor in the circuit in this image has an initial voltage V0 on its terminals at t = 0- when a step of voltage Vu(t) is applied at t = 0. Find an expression for the voltage across the capacitor vC for t > 0.

A circuit containing a step voltage source V in series with a resistor R_2 and a parallel combination of a resistor R_1 and capacitor C. Find the unknown voltage v_C(t) across the capacitor C.

Check your answer




Share this quiz with your friends!

How would your friends do? Click here to send them this link.